View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20413_high_10 (Length: 239)
Name: NF20413_high_10
Description: NF20413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20413_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 14811554 - 14811332
Alignment:
| Q |
1 |
tggctcctttgccactggtaacaaaaagaggattatgcttaggttgggtacaagggttgtaatggatgatagctttctcattcataagtatgggttgact |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811554 |
tggctcctttgccactggtaacagaaagagcattatgcttaggttgggtacaagggttgtaatggatgatagctttctcattcataagtatgggttgact |
14811455 |
T |
 |
| Q |
101 |
ttgcttcgctctgatgagatcaaaaggccacgttttgatcccgctcgattggttggtatctgtttcgtttttgtagtctggtttgctttgtcttactgtt |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811454 |
tcgcttcgctctgatgagatcaaaaggccacgttttgatcccgctcggttggttggtatctgtttcgtttttgtagtctggtttgctttgtcttactgtt |
14811355 |
T |
 |
| Q |
201 |
catttacattttatgtagtctctg |
224 |
Q |
| |
|
||||||| ||||| ||||||||| |
|
|
| T |
14811354 |
tatttaca-tttatttagtctctg |
14811332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University