View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20413_high_11 (Length: 232)
Name: NF20413_high_11
Description: NF20413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20413_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 14104923 - 14105120
Alignment:
| Q |
14 |
attattctggttctaattttctattggnnnnnnnnagagtaattttctattacttttattgttgctttgtttgatgtggcagcttgaccctaaatatatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14104923 |
attattctggttctaattttctattggtttttt---gagtaattttctattatttttattgttgctttgtttgatgtggcagcttgaccctaaatatatg |
14105019 |
T |
 |
| Q |
114 |
ggagttgatgtttcctctgggattccttgctgcaactgggtaattatgcatcttaactttccccttttgctactatttttgtgcatttacaacaacaaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14105020 |
ggagttgatgtttcctctgggattccttgctgcaactgggtaattatgcatcttaactttccccttttgctactatttttgtgcatttacaacaacaaaa |
14105119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University