View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20413_high_5 (Length: 430)
Name: NF20413_high_5
Description: NF20413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20413_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 225 - 382
Target Start/End: Complemental strand, 42249801 - 42249644
Alignment:
| Q |
225 |
aggtcattaataaaaatttgttaggagtttcttaattcttattatatcatcatgtggttggattcaatattattaagcgtggcggaatttgaacaaatca |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42249801 |
aggtcattaataaaaatttgttaggagtttcttaattcttattatatcatcatgtggttggattcaatattattaagcgtggcggaatttgaacaaatca |
42249702 |
T |
 |
| Q |
325 |
ttgttttccgagatgggtgattgacaagactggttgaaatataattttactttgtgta |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42249701 |
ttgttttccgagatgggtgattgacaagactggttgaaatataattttactttgtgta |
42249644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 18 - 142
Target Start/End: Complemental strand, 42250008 - 42249884
Alignment:
| Q |
18 |
tttgcgtttcgattcaattcaatttttgataatcatgaacggtttagtcaacaacggtaacggtggcgtcaaagctgttcttcataaggcggagaagctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42250008 |
tttgcgtttcgattcaattcaatttttgataatcatgaacggtttagtcaacaacggtaacggtggcgtcaaagctgttcttgataaggcggagaagctt |
42249909 |
T |
 |
| Q |
118 |
attattgatactgaccctgggatcg |
142 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42249908 |
attattgatactgaccctgggatcg |
42249884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University