View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20413_low_12 (Length: 259)

Name: NF20413_low_12
Description: NF20413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20413_low_12
NF20413_low_12
[»] chr7 (5 HSPs)
chr7 (16-233)||(28288581-28288798)
chr7 (116-151)||(28320553-28320588)
chr7 (112-148)||(28304384-28304420)
chr7 (123-154)||(28331029-28331060)
chr7 (118-151)||(28309979-28310012)


Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 233
Target Start/End: Original strand, 28288581 - 28288798
Alignment:
16 cacaacgattgtatgcaaagatggccattcatctggggagtttgtgcgagattattggaggaatcattgaagaaagaagagcttccaagattgattctga 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
28288581 cacaacgattgtatgcaaagatggccattcatctggggagtttgtgtgagattattggaggaatcattgaagaaagaagagcttccaagattgattctga 28288680  T
116 tgaggtttgcaatgatgtgttagattcacttcttaacaataatggagaaactattttcgatcagttgagtccgaaggagttgtttcatctgcttccggtt 215  Q
    | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
28288681 tcaggtttgcaatgatgtgttagattcacttcttaacaatgatggagaaactattttcgatcagttgagtccgaaggagatgtttcatctgcttccggtt 28288780  T
216 agtgttattttctcatga 233  Q
    ||||||||||||||||||    
28288781 agtgttattttctcatga 28288798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 116 - 151
Target Start/End: Complemental strand, 28320588 - 28320553
Alignment:
116 tgaggtttgcaatgatgtgttagattcacttcttaa 151  Q
    ||||||||||||||||||||||||||||||||||||    
28320588 tgaggtttgcaatgatgtgttagattcacttcttaa 28320553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 148
Target Start/End: Complemental strand, 28304420 - 28304384
Alignment:
112 ctgatgaggtttgcaatgatgtgttagattcacttct 148  Q
    ||||||||||||||||||||| |||||||||||||||    
28304420 ctgatgaggtttgcaatgatgggttagattcacttct 28304384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 123 - 154
Target Start/End: Complemental strand, 28331060 - 28331029
Alignment:
123 tgcaatgatgtgttagattcacttcttaacaa 154  Q
    ||||||||||||||||||||||||||||||||    
28331060 tgcaatgatgtgttagattcacttcttaacaa 28331029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 118 - 151
Target Start/End: Complemental strand, 28310012 - 28309979
Alignment:
118 aggtttgcaatgatgtgttagattcacttcttaa 151  Q
    |||| |||||||||||||||||||||||||||||    
28310012 aggtgtgcaatgatgtgttagattcacttcttaa 28309979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University