View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20413_low_12 (Length: 259)
Name: NF20413_low_12
Description: NF20413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20413_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 233
Target Start/End: Original strand, 28288581 - 28288798
Alignment:
| Q |
16 |
cacaacgattgtatgcaaagatggccattcatctggggagtttgtgcgagattattggaggaatcattgaagaaagaagagcttccaagattgattctga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28288581 |
cacaacgattgtatgcaaagatggccattcatctggggagtttgtgtgagattattggaggaatcattgaagaaagaagagcttccaagattgattctga |
28288680 |
T |
|
| Q |
116 |
tgaggtttgcaatgatgtgttagattcacttcttaacaataatggagaaactattttcgatcagttgagtccgaaggagttgtttcatctgcttccggtt |
215 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28288681 |
tcaggtttgcaatgatgtgttagattcacttcttaacaatgatggagaaactattttcgatcagttgagtccgaaggagatgtttcatctgcttccggtt |
28288780 |
T |
|
| Q |
216 |
agtgttattttctcatga |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28288781 |
agtgttattttctcatga |
28288798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 116 - 151
Target Start/End: Complemental strand, 28320588 - 28320553
Alignment:
| Q |
116 |
tgaggtttgcaatgatgtgttagattcacttcttaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28320588 |
tgaggtttgcaatgatgtgttagattcacttcttaa |
28320553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 148
Target Start/End: Complemental strand, 28304420 - 28304384
Alignment:
| Q |
112 |
ctgatgaggtttgcaatgatgtgttagattcacttct |
148 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28304420 |
ctgatgaggtttgcaatgatgggttagattcacttct |
28304384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 123 - 154
Target Start/End: Complemental strand, 28331060 - 28331029
Alignment:
| Q |
123 |
tgcaatgatgtgttagattcacttcttaacaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28331060 |
tgcaatgatgtgttagattcacttcttaacaa |
28331029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 118 - 151
Target Start/End: Complemental strand, 28310012 - 28309979
Alignment:
| Q |
118 |
aggtttgcaatgatgtgttagattcacttcttaa |
151 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
28310012 |
aggtgtgcaatgatgtgttagattcacttcttaa |
28309979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University