View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20413_low_13 (Length: 243)
Name: NF20413_low_13
Description: NF20413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20413_low_13 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0742 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 114072 - 113864
Alignment:
| Q |
19 |
ttgcacaaaggaaaaacagtagttacaatacaaattttctgaggggaataatttaaccaatacttgctatttatgtttccatcaagctttgaggaattgg |
118 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
114072 |
ttgcacaaagtaaaaacagtagttacaatgcaaattttctgaggggaataatttaaccaatacttgctatttatgttgccatcaagctttgaggaattgg |
113973 |
T |
 |
| Q |
119 |
tttccaaaatacaaccaaatcttgcagatatatttatatccatttcctaatttaagagctgcaatatcattattctgcataaatatgtttcaaaatttgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113972 |
tttccaaaatacaaccaaatcttgcagatatatttatatccatttcctaatttaagagctgcaatatcattattctgcataaatatgtttcaaaatttgc |
113873 |
T |
 |
| Q |
219 |
actagaatt |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
113872 |
actagaatt |
113864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0742 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0742
Description:
Target: scaffold0742; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 110
Target Start/End: Complemental strand, 181 - 88
Alignment:
| Q |
19 |
ttgcacaaaggaaaaacagtagttacaatacaaattttct--gaggggaataatttaaccaatacttgctatttatgtttccatcaagctttga |
110 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| ||||| |||||||||||||||||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
181 |
ttgcacaaagtaaaaacagtagttacaatgcaaaatttctatgaggggaataatttaaccaatacttgatatttatatagccatcaagctttga |
88 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University