View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20414_low_9 (Length: 230)
Name: NF20414_low_9
Description: NF20414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20414_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 2373861 - 2373994
Alignment:
| Q |
1 |
ggaaagccgaggaggtggctaggaagaaagtcaagagggcaaagaaagccgaggaggcagaggcaaaggcaaaggattaatgaatatttcaagaattaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2373861 |
ggaaagccgaggaggtggctaggaagaaagtcaagagggcaaagaaagccgaggaggcagaggcaaaggcaaaggattaatgaatatttcaagaattaga |
2373960 |
T |
|
| Q |
101 |
gaaggactagatttgcactattatgtttttcatg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2373961 |
gaaggactagatttgcactattatgtttttcatg |
2373994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 2382210 - 2382077
Alignment:
| Q |
1 |
ggaaagccgaggaggtggctaggaagaaagtcaagagggcaaagaaagccgaggaggcagaggcaaaggcaaaggattaatgaatatttcaagaattaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2382210 |
ggaaagccgaggaggtggctaggaagaaagtcaagagggcaaagaaagccgaggaggcagaggcaaaggcaaaggattaatgaatatttcaagaattaga |
2382111 |
T |
|
| Q |
101 |
gaaggactagatttgcactattatgtttttcatg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2382110 |
gaaggactagatttgcactattatgtttttcatg |
2382077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 17 - 134
Target Start/End: Complemental strand, 2839472 - 2839355
Alignment:
| Q |
17 |
ggctaggaagaaagtcaagagggcaaagaaagccgaggaggcagaggcaaaggcaaaggattaatgaatatttcaagaattagagaaggactagatttgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2839472 |
ggctaggaagaaagtcaagagggcaaagaaagccgaggaggcgaaggcaaaggcaaaggagtaatgaatatttcaagaattagagaaggactagatttgc |
2839373 |
T |
|
| Q |
117 |
actattatgtttttcatg |
134 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2839372 |
actattatgtttttcatg |
2839355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 6 - 57
Target Start/End: Original strand, 2373824 - 2373875
Alignment:
| Q |
6 |
gccgaggaggtggctaggaagaaagtcaagagggcaaagaaagccgaggagg |
57 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2373824 |
gccgaggaggaggctaggaagaaagtcaagagggcaaggaaagccgaggagg |
2373875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 2382247 - 2382196
Alignment:
| Q |
6 |
gccgaggaggtggctaggaagaaagtcaagagggcaaagaaagccgaggagg |
57 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2382247 |
gccgaggaggaggctaggaagaaagtcaagagggcaaggaaagccgaggagg |
2382196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 80 - 109
Target Start/End: Complemental strand, 1525897 - 1525868
Alignment:
| Q |
80 |
atgaatatttcaagaattagagaaggacta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1525897 |
atgaatatttcaagaattagagaaggacta |
1525868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University