View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20415_high_8 (Length: 239)
Name: NF20415_high_8
Description: NF20415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20415_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 54 - 121
Target Start/End: Complemental strand, 32267248 - 32267181
Alignment:
| Q |
54 |
taaaatatttcttagtttatttttctcatataaaattaaccacaattcttaatatttgtaaaaatgtc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267248 |
taaaatatttcttagtttatttttctcatataaaattaaccacaattcttaatatttgtaaaaatgtc |
32267181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 32267116 - 32267080
Alignment:
| Q |
186 |
aatttctctgcagtactcagctgaggtagatgttgct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267116 |
aatttctctgcagtactcagctgaggtagatgttgct |
32267080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University