View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20415_low_9 (Length: 218)
Name: NF20415_low_9
Description: NF20415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20415_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 21 - 203
Target Start/End: Complemental strand, 22324989 - 22324807
Alignment:
| Q |
21 |
aatgtagttgagaggatgaagatagcataccgctatgacttgaagactttgaggaatcagtgtgctcgtttacttgtggagtttaaaaaattgcacaccc |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22324989 |
aatgtagttgagaggatgaagataacataccgctatgacttgaagactttgaggaatcagtgtgctcgtttacttgtggagtttaaaaaattgcacaccc |
22324890 |
T |
 |
| Q |
121 |
ttcggacagaaattcgtgcttaccgtagaactgttgatatggatacaattagcaaaatgttttctgatttttgtacctttgct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22324889 |
ttcggacagaaattcgtgcttaccgtagaactgttgatatggatacaattagcaaaatgttttctgatttttgtacctttgct |
22324807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University