View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20416_low_8 (Length: 206)
Name: NF20416_low_8
Description: NF20416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20416_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 34149598 - 34149727
Alignment:
| Q |
17 |
cagagaaggacgaagtagtgttgttgttgttgaattcatggtatcgttttgtaaatttcaaagacacaaagagtggtttggttaatataatagttctgtg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34149598 |
cagagaaggacgaagtagtgttgttgttgttgaattcatggtatcgttttgtaaatttcaaagacacaaagagtggtttggttaatataatagttct--- |
34149694 |
T |
|
| Q |
117 |
gaagttactctatttggataaggatgatattttcctagatattt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34149695 |
-----------atttggataaggatgatattttcctagatattt |
34149727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University