View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20417_high_2 (Length: 260)
Name: NF20417_high_2
Description: NF20417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20417_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 253
Target Start/End: Original strand, 8136081 - 8136326
Alignment:
| Q |
9 |
cacagacaatagagaaacatgtggcatcagccaatgtttaattttgttggtggtattgttggcttcatctacaatgacataataatatttactgtgatgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8136081 |
cacagacaatagagaaacatgtggcatcagccaatgtttaattttgttggtggtattgttggcttcatctacaatgacataataatatttactgtgatgc |
8136180 |
T |
 |
| Q |
109 |
catctttattttcattattattatcttgtagtgaacg-nnnnnnnnnnnnnnnnngcaccttacaactttatatagatggtgacgtatcgtctatgactt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8136181 |
catctttattttcattattattatcttgtagtgaacgttttttttttctttttttgcaccttacaactttatatagatggtgacgtatcgtctatgactt |
8136280 |
T |
 |
| Q |
208 |
ccaagactttattccttcttgtcttaataatggtggatgatgatgt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8136281 |
ccaagactttattccttcttgtcttaataatggtggatgatgatgt |
8136326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University