View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20417_high_3 (Length: 257)
Name: NF20417_high_3
Description: NF20417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20417_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 35364121 - 35363897
Alignment:
| Q |
18 |
ccattttcccgagaaaatcaccaacacagcacaagaacaacaacaatcaatcgatgatctacttaccgtgattccactcgaggacgaagacgatgatgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364121 |
ccattttcccgagaaaatcaccaacacagcacaagaacaacaacaatcaatcgatgatctacttaccgtgattccactcgaggacgaagacgatgatgag |
35364022 |
T |
|
| Q |
118 |
gtcgacccctcatggaacaaaatctaaatctcacattgctcacaacttccactgatccagatgatgttcgactgattgagtgggaagattttgagcatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364021 |
gtcgacccctcatggaacaaaatctaaatctcacattgctcacaacttccactgatccagatgatgttcgactgattgagtgggaagattttgagcatga |
35363922 |
T |
|
| Q |
218 |
tcttgctaggttatcgagtctctct |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35363921 |
tcttgctaggttatcgagtctctct |
35363897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 35364815 - 35364756
Alignment:
| Q |
18 |
ccattttcccgagaaaatcaccaacacagcacaagaacaacaacaatcaatcgatgatct |
77 |
Q |
| |
|
|||| |||| |||||||||| ||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
35364815 |
ccatattcctgagaaaatcatcaacacaccacaagaacaacaagaatcaattgatgatct |
35364756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University