View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20418_high_8 (Length: 234)

Name: NF20418_high_8
Description: NF20418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20418_high_8
NF20418_high_8
[»] chr7 (1 HSPs)
chr7 (77-189)||(32618197-32618309)


Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 77 - 189
Target Start/End: Complemental strand, 32618309 - 32618197
Alignment:
77 caaactttctaatccccatcttcttctcttcaatttattttgtaggttttcaaactttctaatctctatcttctcctcttcaattgtattttgcagaaaa 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32618309 caaactttctaatccccatcttcttctcttcaatttattttgtaggttttcaaactttctaatctctatcttctcctcttcaattgtattttgcagaaaa 32618210  T
177 cttgaagtgctgt 189  Q
    |||||||||||||    
32618209 cttgaagtgctgt 32618197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University