View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20418_high_8 (Length: 234)
Name: NF20418_high_8
Description: NF20418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20418_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 77 - 189
Target Start/End: Complemental strand, 32618309 - 32618197
Alignment:
| Q |
77 |
caaactttctaatccccatcttcttctcttcaatttattttgtaggttttcaaactttctaatctctatcttctcctcttcaattgtattttgcagaaaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32618309 |
caaactttctaatccccatcttcttctcttcaatttattttgtaggttttcaaactttctaatctctatcttctcctcttcaattgtattttgcagaaaa |
32618210 |
T |
 |
| Q |
177 |
cttgaagtgctgt |
189 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32618209 |
cttgaagtgctgt |
32618197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University