View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20419_high_6 (Length: 253)
Name: NF20419_high_6
Description: NF20419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20419_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 109 - 250
Target Start/End: Original strand, 38629627 - 38629768
Alignment:
| Q |
109 |
tgtgtgaccgcttatactcttcatcaattcaagggtatatgtgcaatccagtgtaatagaacatgaaatagtgaattactcttcgaattatatatgttgg |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38629627 |
tgtgttaccgcttatactcttcatcaattcaagggtatatgtgcaatccagtgtaatagaacatgaaatagtgaattactcttcgaattatatatgttgg |
38629726 |
T |
|
| Q |
209 |
attggatcatttcaatatttactgcctacagatttggttctt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38629727 |
attggatcatttcaatatttactgcctatagatttggttctt |
38629768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 109 - 188
Target Start/End: Complemental strand, 38696630 - 38696548
Alignment:
| Q |
109 |
tgtgtgaccgcttatactcttcatcaattcaagggtatatgtgcaatccagtgtaatagaacatgaaa---tagtgaattact |
188 |
Q |
| |
|
|||||||||| || ||||||| ||||||||||| ||||||||| |||| ||||||||| ||| ||||| |||||||||||| |
|
|
| T |
38696630 |
tgtgtgaccgtttgtactctttatcaattcaagtgtatatgtgaaatcaagtgtaataaaacgtgaaaaggtagtgaattact |
38696548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University