View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20419_low_3 (Length: 316)
Name: NF20419_low_3
Description: NF20419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20419_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 50384415 - 50384150
Alignment:
| Q |
1 |
cacttatggttatagaagtagtgaggcatgtataaatgagatggagcaacttgctgaattgaatatttattgatttagaaaaacaaatgttggtgctctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
50384415 |
cacttatggttatagaagtagtgagg----tataaatgagatggagcaacttgctgaattgaatatttataaatttagaaaaacaaatgttggcgctctt |
50384320 |
T |
|
| Q |
101 |
atttgttgctaatgttgacttctttgcatatggagaagaacgatgtggccaacctttcacattcagtgatattattattcttatgcatgtttcctccaac |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50384319 |
atttgttgctattgttgacttctttgcatatggagaagaacgatgtggccaacctttcacattcagtgatattattattcttatgcatgtttcctccaac |
50384220 |
T |
|
| Q |
201 |
aatctagatggttatatttttaaaaggaaactaaaattgatttaaaactcttttcaagtttcatatgcat |
270 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50384219 |
aatctagatggttatattttaaaaaagaaactaaaattgatgtaaaactcttttcaagtttcatatgcat |
50384150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University