View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20419_low_9 (Length: 229)
Name: NF20419_low_9
Description: NF20419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20419_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 13 - 139
Target Start/End: Complemental strand, 50936429 - 50936303
Alignment:
| Q |
13 |
aagaatatcggactacatactcggaggagctttcaaaacgcttggtttcaaagctgagcggaaagttggaggtaccaaattactactgagtatacactca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50936429 |
aagaatatcggactacatactcggaggagctttcaaaaagcttggtttcgaagctgagcggaaagttggaggtaccaaattactactgagtatacactca |
50936330 |
T |
 |
| Q |
113 |
atgatcatgttattcaaattacatgac |
139 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
50936329 |
atgatcatgttattcaaattacatgac |
50936303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 27 - 133
Target Start/End: Original strand, 26558191 - 26558299
Alignment:
| Q |
27 |
acatactcggaggagctttcaaaacgcttggtttcaaagctgagcggaaagttggaggtaccaaattactact--gagtatacactcaatgatcatgtta |
124 |
Q |
| |
|
|||||| ||||||||||||| ||| |||| |||||| |||| || |||||||| ||||||| ||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
26558191 |
acatacgcggaggagctttctaaatgcttagtttcagagctaagaggaaagttagaggtactaaattactaatgagagtatacactcaatgatcatgtta |
26558290 |
T |
 |
| Q |
125 |
ttcaaatta |
133 |
Q |
| |
|
||||||||| |
|
|
| T |
26558291 |
ttcaaatta |
26558299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 89
Target Start/End: Original strand, 26563517 - 26563593
Alignment:
| Q |
13 |
aagaatatcggactacatactcggaggagctttcaaaacgcttggtttcaaagctgagcggaaagttggaggtacca |
89 |
Q |
| |
|
|||||||||| || |||||| ||||||||||||| |||||| | ||||| |||||||||||||||| ||||||||| |
|
|
| T |
26563517 |
aagaatatcgaacaacatacgcggaggagctttctaaacgcctaatttcagagctgagcggaaagttagaggtacca |
26563593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University