View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20420_high_25 (Length: 269)
Name: NF20420_high_25
Description: NF20420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20420_high_25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 269
Target Start/End: Original strand, 4670563 - 4670819
Alignment:
| Q |
17 |
acttttgtccttctagtattttgttatattcaaagcttgttatgtagtttgaaataaatcaacaaactcatattgttgaagccttccttcaaaatcaaga |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4670563 |
acttttgtccttctagtatattgttatattcaaagcttgttatgtagtttgaaataaatcaacaaactcatattgttgaagccttccttcaaaatcaaga |
4670662 |
T |
 |
| Q |
117 |
ttaaccatcttgttgtcattgtctctaaatgannnnnnnataacgacgacttctcaatgatgataaatcactagtggattcgtcaatatacgattatatg |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
4670663 |
ttaaccatcttgatgtcattgtctctaaatgatttttttataactacgacttctcaatgatgataaatcactagtggatttgtcaatatatgattatatg |
4670762 |
T |
 |
| Q |
217 |
cgttgcatttacaatcgtgcttactc----tgcattcgtaatttcttgcaactgctt |
269 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4670763 |
cgttgcacttacaatcgtgcttactctgcatgcattcgtaatttcttgcaactgctt |
4670819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University