View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20420_high_31 (Length: 229)

Name: NF20420_high_31
Description: NF20420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20420_high_31
NF20420_high_31
[»] chr7 (1 HSPs)
chr7 (27-151)||(47802393-47802517)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 27 - 151
Target Start/End: Complemental strand, 47802517 - 47802393
Alignment:
27 gttcaggttgttttctcttgattttttctctgttttgagccattgtaaaatgtgcagcagcaagatagagtgtcacgctcactctagattctaccgtttt 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47802517 gttcaggttgttttctcttgattttttctctgttttgagccattgtaaaatgtgcagcagcaagatagagtgtcacgctcactctagattctaccgtttt 47802418  T
127 gtcttcaaattaatgatgatgctat 151  Q
    |||||||||||||||||||||||||    
47802417 gtcttcaaattaatgatgatgctat 47802393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University