View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20420_low_21 (Length: 321)
Name: NF20420_low_21
Description: NF20420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20420_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 41 - 301
Target Start/End: Original strand, 45756907 - 45757167
Alignment:
| Q |
41 |
aatattcttttcgatggtacttttgtcaataatgtttggttcttctcacatgaagatttcaccttattagatattcgcattttgcgatcattattaactt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
45756907 |
aatattcttttcgatggtacttttgtcaataatgtttggttcttctcacattaagatttcaccttattagatattcgcattttgccaccattattaactt |
45757006 |
T |
|
| Q |
141 |
attattactcttattcttttttcttctagatctttcgtatctactacaagtaacgtgctttttnnnnnnnntggtaacataccactaattagagttccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45757007 |
attattactcttattcttttttcttctagatctttcgtatctactacaagtaacgtgctttttaaaaaaaatggtaacataccactaattagagttccaa |
45757106 |
T |
|
| Q |
241 |
tggatttttatacggcaaattgttgtattgaccaccttgataagttgttgacagtagatta |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45757107 |
tggatttttatacggcaaattgttgtattgaccaccttgataagttgttgacagtagatta |
45757167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 45756825 - 45756869
Alignment:
| Q |
1 |
ggtactaacaaacttaaattttgggaaaacatttgctatgaatat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45756825 |
ggtactaacaaacttaaattttgggaaaacatttgctatgaatat |
45756869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University