View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20420_low_23 (Length: 318)
Name: NF20420_low_23
Description: NF20420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20420_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 5192777 - 5192469
Alignment:
| Q |
1 |
aagtgtccaatagagagagatgtcttgtatttttggaaaaataagtattgg---tagtctcattttgttgttaatgtttgtctttgaggatattatcttg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5192777 |
aagtgtccaatagagagagatgtcttgtatttttggaaaaataagtattggcggtagtctcattttgttgttaatgtttgtctttgagg-tattatcttg |
5192679 |
T |
|
| Q |
98 |
ttttagacctttatat--gtctttgtcattcttttgagttttgaaatcaaagccattgaatccctaatatccatacctacattttttatgaagacatcta |
195 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5192678 |
ttttagacctttatatatgtctttgtcattcttttgagttttgaaatcaaagccattgaatccctaaaatccatacctacattttttatgaagacatcta |
5192579 |
T |
|
| Q |
196 |
tatataaccttgacgttaacttatatgattctacgcgatctcgttgtggtgtgacgagcttgcctaggtatattttttctagcttacgcatgagacacaa |
295 |
Q |
| |
|
|| ||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5192578 |
tacataaccttgacgttaacttgtgtgattctaggcgatctcgttgtggtgtgacgagcttgcctaggtatattttttttagattacgcatgagacacaa |
5192479 |
T |
|
| Q |
296 |
cgactggcct |
305 |
Q |
| |
|
|||||||||| |
|
|
| T |
5192478 |
cgactggcct |
5192469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University