View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20420_low_29 (Length: 238)
Name: NF20420_low_29
Description: NF20420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20420_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 42095527 - 42095341
Alignment:
| Q |
1 |
ccaagcatcgttaactatgtacata----cttgtgaaaagtgacataagccgtatgatagtttgttgtttaatttgttcaattttatgttcatggtttgt |
96 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42095527 |
ccaagcatcgttaactatttacatatatacttgtgaaaagtgacataagccgtatgatagtttgttgtttaatttgttcaattttatgttcatggtttgt |
42095428 |
T |
 |
| Q |
97 |
atccccttttgtgttctcccaataatactatatttagttctaggaagtgnnnnnnnngcaactgtaaccatgtcgtgcaagatcata |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
42095427 |
atccccttttgtgttctcccaataatactatatttagttcttggaagtgttttttttgcaactgtaaccgtgtcgtgcaagatcata |
42095341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University