View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20420_low_32 (Length: 229)
Name: NF20420_low_32
Description: NF20420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20420_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 27 - 151
Target Start/End: Complemental strand, 47802517 - 47802393
Alignment:
| Q |
27 |
gttcaggttgttttctcttgattttttctctgttttgagccattgtaaaatgtgcagcagcaagatagagtgtcacgctcactctagattctaccgtttt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47802517 |
gttcaggttgttttctcttgattttttctctgttttgagccattgtaaaatgtgcagcagcaagatagagtgtcacgctcactctagattctaccgtttt |
47802418 |
T |
|
| Q |
127 |
gtcttcaaattaatgatgatgctat |
151 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47802417 |
gtcttcaaattaatgatgatgctat |
47802393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University