View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20420_low_34 (Length: 227)

Name: NF20420_low_34
Description: NF20420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20420_low_34
NF20420_low_34
[»] chr3 (4 HSPs)
chr3 (7-227)||(15751877-15752097)
chr3 (43-196)||(15287281-15287433)
chr3 (111-185)||(54501193-54501267)
chr3 (112-177)||(11295412-11295477)
[»] chr4 (1 HSPs)
chr4 (117-189)||(26306624-26306696)
[»] chr8 (5 HSPs)
chr8 (117-177)||(27476703-27476763)
chr8 (117-177)||(30266207-30266267)
chr8 (117-177)||(32796243-32796303)
chr8 (117-177)||(32811910-32811970)
chr8 (117-177)||(33121877-33121937)
[»] chr5 (5 HSPs)
chr5 (117-189)||(7994892-7994964)
chr5 (117-177)||(9011857-9011917)
chr5 (117-177)||(39124643-39124703)
chr5 (117-177)||(39137972-39138032)
chr5 (117-177)||(39682982-39683042)
[»] chr1 (1 HSPs)
chr1 (117-177)||(37079612-37079672)
[»] chr6 (1 HSPs)
chr6 (117-177)||(4869395-4869455)
[»] chr7 (1 HSPs)
chr7 (117-157)||(5041445-5041485)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 15752097 - 15751877
Alignment:
7 gactgtagttataaaaaatgttagtatgaatcaattagtattctactaaaagacaataaatatcgcattgtgtaataaataatagatgtcaagaacatac 106  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||| | ||||    
15752097 gactgtagttataaaaaatgttagtatgaatcagttagtattctactaaaagacaataaatatcgtattgtgtaatacataatagttgtcaagtatatac 15751998  T
107 aacaatccgatgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggcatcggaactttttagatttttacaatttga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
15751997 aacaatccgatgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggcatcggaa-tttttagatttttacaatttga 15751899  T
207 aaacaataattt-tttcgcaat 227  Q
    |||||||||||| |||||||||    
15751898 aaacaataatttgtttcgcaat 15751877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 43 - 196
Target Start/End: Original strand, 15287281 - 15287433
Alignment:
43 agtattctactaaaagacaataaatatcgcattgtgtaataaataatagatgtcaagaacatacaacaatccgatgtcgtccagcggttaggatatctgg 142  Q
    |||||||| |||||||| ||||| |   | ||||| ||||| || | || ||||||||| || ||| |||||||||||||||||||||||||||||||||    
15287281 agtattctgctaaaagaaaataactgctgtattgtataatagatgacagttgtcaagaatattcaataatccgatgtcgtccagcggttaggatatctgg 15287380  T
143 ctttcacccaggagacccgggttcgattcccggcatcggaactttttagatttt 196  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
15287381 ctttcacccaggagacccgggttcgattcccggcatcggaa-tttttagatttt 15287433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 111 - 185
Target Start/End: Complemental strand, 54501267 - 54501193
Alignment:
111 atccgatgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggcatcggaact 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54501267 atccgatgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggcatcggaact 54501193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 11295412 - 11295477
Alignment:
112 tccgatgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
11295412 tccgttgtcgtccagcgattaggatatctggctttcacccaggagacccgggttcgattcccggca 11295477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 117 - 189
Target Start/End: Complemental strand, 26306696 - 26306624
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggcatcggaacttttt 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
26306696 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggcaatggaacttttt 26306624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 61; Significance: 2e-26; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 27476763 - 27476703
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27476763 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 27476703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 30266207 - 30266267
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30266207 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 30266267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 32796243 - 32796303
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32796243 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 32796303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 32811910 - 32811970
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32811910 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 32811970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 33121877 - 33121937
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33121877 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 33121937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 189
Target Start/End: Complemental strand, 7994964 - 7994892
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggcatcggaacttttt 189  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||||||||    
7994964 tgtcgtccagcggttaggatgtctggctttcacccaggagacccgggttcgattcccggcaatggaacttttt 7994892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 9011917 - 9011857
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9011917 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 9011857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 39124643 - 39124703
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39124643 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 39124703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 39137972 - 39138032
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39137972 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 39138032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 39683042 - 39682982
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39683042 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 39682982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 37079672 - 37079612
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37079672 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 37079612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 4869455 - 4869395
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggttcgattcccggca 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||    
4869455 tgtcgtccagcggttaggatatctggctttcacccaggagacccgggtacgattccaggca 4869395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 117 - 157
Target Start/End: Original strand, 5041445 - 5041485
Alignment:
117 tgtcgtccagcggttaggatatctggctttcacccaggaga 157  Q
    |||||||||||||||||||||||||||||||||| ||||||    
5041445 tgtcgtccagcggttaggatatctggctttcacctaggaga 5041485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University