View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20422_low_7 (Length: 262)
Name: NF20422_low_7
Description: NF20422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20422_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 4242252 - 4242006
Alignment:
| Q |
1 |
tggctaacattacataaaacaggttttggaattatatcaacaattcatttccacattttcttttgtggtttgtgcgttaaatgaatgtttacgtatcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4242252 |
tggctaacattacataaaacaggttttggaattatatcaacaattcatttccacattttcttttgtggtttgtgcgttaaatgaatgtttacatatcaat |
4242153 |
T |
|
| Q |
101 |
ggtcatgaatctctgctctacatgacctgtttacgtatcttttgttggctaattcgtgtgtttacattggcttatcagtttgatcattcagcacttagca |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
4242152 |
gctcatgaatctctgctctacatgacctgtttacatatcttttgttggctaattcgtgtgtttacattggcttatcagtttgatcactcagcacttggca |
4242053 |
T |
|
| Q |
201 |
ggaaaaaggagcattaatctctgcattgtgcagttgtaagaagtaaa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4242052 |
ggaaaaaggagcattaatctctgcattgtgcagttgtaagaagtaaa |
4242006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University