View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20422_low_9 (Length: 240)
Name: NF20422_low_9
Description: NF20422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20422_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 78 - 223
Target Start/End: Complemental strand, 5447678 - 5447533
Alignment:
| Q |
78 |
tcaatacggacaatatttcaaaaacacaatgttgtacttgagatcgaaacaataagtaataaattaaagtaaatataatagtttaaatcttatttctcaa |
177 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5447678 |
tcaaaacggacaatatttcaaaagcacaatgttgtagttgagatcgaaacaataagtaataaattaaagtaaatataatagtttaaatcttattcctcaa |
5447579 |
T |
 |
| Q |
178 |
gttattataagaagagtttattgataatataaagtttaaacgagaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
5447578 |
gttattataagaagagtttattgataatctaaagttcaaatgagaa |
5447533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 5447795 - 5447729
Alignment:
| Q |
9 |
ataattctctcattgtttggaagtctagattaaatgtagtttataaactatacattcttcttaaccaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5447795 |
ataattctctcattgtttggaagtctagattaaa--tagtttataaactatacattcttcttaaccaaa |
5447729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University