View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20423_low_2 (Length: 280)
Name: NF20423_low_2
Description: NF20423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20423_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 43951961 - 43951696
Alignment:
| Q |
1 |
caggaggatcttatccaatatcttgaattgattgaacaaatccaagttggctttttatcactcaatattgaatgtgacattctccacctaatttattaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43951961 |
caggaggatcttatccaatatcttgaattgattgaaccaatccaagttggctttttatcactcaatattgaatgtgacattctctacctaatttattaat |
43951862 |
T |
 |
| Q |
101 |
ggtaatagaaggctaactcaca--agtcaaaatacgttcatcaaagaaattggaatcatataccaaccagtccaaccttacctgtaacattaagagttca |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43951861 |
ggtaatagaaggctaactcacacaagtcaaaatatgttcatcaaagaaattggaatcatataccaaccagtccaaccttacctgtaacattaagagttca |
43951762 |
T |
 |
| Q |
199 |
aatattatagtttacttgcaaacaaaacaaaactattcaactatgtgaagcaccgcacaaattaat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43951761 |
aatattatagtttacttgcaaacaaaacaaaactattcaactatgtgaagcaccgcacaaattaat |
43951696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University