View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_high_21 (Length: 320)
Name: NF20424_high_21
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 11 - 304
Target Start/End: Original strand, 10557037 - 10557330
Alignment:
| Q |
11 |
ccaagaatatcatctctaactacgacgcaccagaaggtgtcgaagttaggggaagatatgatgcagagtttgcaaaaattctaaccaaagatgctttgaa |
110 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557037 |
ccaagaatatcatctctaactacgatgcaccagaaggcgtcgaagttaggggaagatatgatgcagagtttgcaaaaattctaaccaaagatgctttgaa |
10557136 |
T |
 |
| Q |
111 |
atttgttgctgatttgcaacgtgagttcagaaaccatataaagtatgcactagagtgtagaaaagaagcaaagagaaggtacaatgaaggagctctacca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557137 |
atttgttgctgatttgcaacgtgagttcagaaaccatataaagtatgcactagagtgtagaaaagaagcaaagagaaggtacaatgaaggagctctacca |
10557236 |
T |
 |
| Q |
211 |
ggttttgatccagcaactagatacataagagaaggagattggatctgtgcacctgttccaccagctgtttctgataggaaagttgagattactg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557237 |
ggttttgatccagcaactagatacataagagaaggagattggatctgtgcacctgttccaccagctgtttctgataggaaagttgagattactg |
10557330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University