View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20424_high_35 (Length: 262)

Name: NF20424_high_35
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20424_high_35
NF20424_high_35
[»] chr6 (2 HSPs)
chr6 (165-244)||(17362603-17362682)
chr6 (1-72)||(17362734-17362805)


Alignment Details
Target: chr6 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 17362682 - 17362603
Alignment:
165 aacacaatagatatgaacataacaggcataaacacttctgatcaacatctcaaatcaactgttgagagtgaagaaaatgc 244  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
17362682 aacacaattgatatgaacataacaggcataaacacttctgatcaacatctcaaatcaactgttgagagtaaagaaaatgc 17362603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 17362805 - 17362734
Alignment:
1 taccataaaattaataatcacatccacttcttaatgtgttacttcttaatgctttgttatataaatcagttc 72  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
17362805 taccataaaattaataatcacatccacttcttaatgtgttacttcttaatgccttgttatataaatcagttc 17362734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University