View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_high_39 (Length: 251)
Name: NF20424_high_39
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 26292573 - 26292345
Alignment:
| Q |
19 |
agaggtgttagaatttgtggtagaatcagaacgacccattccaccaaaatgctgactaaaagaagaagaaaacggaggcgaagggctctggtggtgggca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26292573 |
agaggtgttagaatttgtggtagaatcagaacgacccattccaccaaaatgctgactaaaagaagaagaaaacggaggcgaagggctctggtggtgggca |
26292474 |
T |
|
| Q |
119 |
ggtacaccgattgccataccgcctctcggcgcggaagccgaggaaatcgacgaagcgggattggacggaaaagatgaagcctgtgaaggattagcggaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26292473 |
ggtacaccgattgccataccgcctctcggcgcggaagccgaggaaatcgacgaagcgggattggacggaaaagatgaagcctgtgaaggattagcggaag |
26292374 |
T |
|
| Q |
219 |
gtgggattgatgagaagtgagaataatgt |
247 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
26292373 |
gtgggattgatgagaagtgagagtaatgt |
26292345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University