View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_low_25 (Length: 300)
Name: NF20424_low_25
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 15 - 171
Target Start/End: Original strand, 4101021 - 4101177
Alignment:
| Q |
15 |
cagagacctact-gtggttatcaatagagctattgtgttgaacacaaactttcggttgcacattctcggaccggccttcatctttatttacctccactgt |
113 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4101021 |
cagagacctacttgtggttatcaatagagctattgtgttgaacacaaactttcggttacacattctcggaccggccttcatctttatttacct-cactgt |
4101119 |
T |
 |
| Q |
114 |
ttccctcattatgcaaattcttctcactacgagatgctctcgacatattctccccttt |
171 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4101120 |
ttcccttattatgcaaattcttctcactacgagatgctcttgacatattctccccttt |
4101177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 163 - 285
Target Start/End: Original strand, 4101682 - 4101804
Alignment:
| Q |
163 |
ctcccctttgctggacaggatatccagtatccactaataactttagaatttcagtctatttcacgtagactttattggagaatgaatagaatagacttta |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4101682 |
ctcccctttgctggacaggatatccagtatccactaataactttagaatttcagtctatttcacgaagactttattggagaatgaatagaatagacttta |
4101781 |
T |
 |
| Q |
263 |
tgatgagggtttccggattttat |
285 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
4101782 |
tgctgagggtttccggattttat |
4101804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 113 - 258
Target Start/End: Original strand, 4138504 - 4138641
Alignment:
| Q |
113 |
tttccctcattatgcaaattcttctcactacgagatgctctcgacatattctcccctttgctggacaggatatccagtatccactaataactttagaatt |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
4138504 |
tttccctcattctgcaaattcttctcactacgagatgctcttgacatattctcccctttgctggacagga-------tatctacaaataactttagaatt |
4138596 |
T |
 |
| Q |
213 |
tcagtctatttcacgtagactttattggagaatgaatagaatagac |
258 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||||||| | |||||| |
|
|
| T |
4138597 |
tcagtctatttcacaaagacttta-tggggaatgaattgtatagac |
4138641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 31 - 103
Target Start/End: Original strand, 4109382 - 4109454
Alignment:
| Q |
31 |
ttatcaatagagctattgtgttgaacacaaactttcggttgcacattctcggaccggccttcatctttattta |
103 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109382 |
ttatcaaaagtgctattgtgttgaacacaaactttcggttgcacattctcggaccggccttcatctttattta |
4109454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 4132567 - 4132637
Alignment:
| Q |
31 |
ttatcaatagagctattgtgttgaacacaaactttcggttgcacattctcggaccggccttcatctttatt |
101 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||||||||| |||||||||| |||| | |||| |||||||| |
|
|
| T |
4132567 |
ttatcaaaagagccattgtgttcaacacaaactttcgggggcacattctcagacctgacttcgtctttatt |
4132637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University