View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_low_27 (Length: 291)
Name: NF20424_low_27
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 11 - 273
Target Start/End: Complemental strand, 17393003 - 17392740
Alignment:
| Q |
11 |
cacagaaaatgatagttgcttatgcgagattgtgctgcgtgaaggtggaacaatcagaattttaagggtgcacgttgttaggaaggaatgaaccaaactg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17393003 |
cacagaaaatgatagttgcttatgcgagattgtgctgcgtgaagatggaacaatcagaattttaagggtgcacgttgttaggaaggaatgaaccaaactg |
17392904 |
T |
 |
| Q |
111 |
caata-aacagtacagatgttaacttgaaacttctaagatggaacttgtttatttataaaacatttttatcaagtgtgcttttataacttctaaaatggt |
209 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17392903 |
caatacaatagtactgatgttaacttgaaacttctaagatggaacttgtttatttataaaacatttttatcaagtgtgcttttataacttctaaaatggt |
17392804 |
T |
 |
| Q |
210 |
gtttgtaatgactatgatgaccatttttatgacttattgtataattatttagcttgcactgacc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17392803 |
gtttgtaatgactatgatgaccatttttatgacttattgtataattatttagcttgcactgacc |
17392740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University