View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_low_32 (Length: 267)
Name: NF20424_low_32
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 17469324 - 17469457
Alignment:
| Q |
1 |
agttaaaaggcttattaaggaacacatcaaagatgggtaccaagtggcttttattggcatcaacattgatatgaatgtcactcacatgaaccaattcacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17469324 |
agttaaaaggcttattaaggaacacatcaaagataggtaccaagtggcttttattggcatcaacattgatatgaatgtcactcacatgaaccaattcacc |
17469423 |
T |
 |
| Q |
101 |
gttctctactcaacccagcaaattatgttactat |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
17469424 |
gttctctactcaccccagcaaattatgttactat |
17469457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 174 - 252
Target Start/End: Original strand, 17469458 - 17469536
Alignment:
| Q |
174 |
gattcatgaacatagtaggaccatgggtggaagtcgaagtttcatgcgcctttctgacaacattttgacccatgaaatt |
252 |
Q |
| |
|
|||| |||||| ||||| || ||||||||||||||||||||||||| ||| || ||| || |||||||| |||||||| |
|
|
| T |
17469458 |
gattgatgaacttagtaagaggatgggtggaagtcgaagtttcatgcacctatccgacgacgttttgaccaatgaaatt |
17469536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University