View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20424_low_32 (Length: 267)

Name: NF20424_low_32
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20424_low_32
NF20424_low_32
[»] chr2 (2 HSPs)
chr2 (1-134)||(17469324-17469457)
chr2 (174-252)||(17469458-17469536)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 17469324 - 17469457
Alignment:
1 agttaaaaggcttattaaggaacacatcaaagatgggtaccaagtggcttttattggcatcaacattgatatgaatgtcactcacatgaaccaattcacc 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17469324 agttaaaaggcttattaaggaacacatcaaagataggtaccaagtggcttttattggcatcaacattgatatgaatgtcactcacatgaaccaattcacc 17469423  T
101 gttctctactcaacccagcaaattatgttactat 134  Q
    |||||||||||| |||||||||||||||||||||    
17469424 gttctctactcaccccagcaaattatgttactat 17469457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 174 - 252
Target Start/End: Original strand, 17469458 - 17469536
Alignment:
174 gattcatgaacatagtaggaccatgggtggaagtcgaagtttcatgcgcctttctgacaacattttgacccatgaaatt 252  Q
    |||| |||||| ||||| ||  ||||||||||||||||||||||||| ||| || ||| || |||||||| ||||||||    
17469458 gattgatgaacttagtaagaggatgggtggaagtcgaagtttcatgcacctatccgacgacgttttgaccaatgaaatt 17469536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University