View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_low_34 (Length: 267)
Name: NF20424_low_34
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_low_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 5038189 - 5037947
Alignment:
| Q |
8 |
ccaagaatattggaactcttattttattagatgggagcatgtgacactgcgtgcagtttggtccctcttggtctgtcaatttatatatcataatgcaaat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5038189 |
ccaaaaatattggaactcttattttattagatgggagcatgtgacactgcgtgcagtttggtccctcttggtctgtcaatttatatatcataatgcaaat |
5038090 |
T |
|
| Q |
108 |
atttaatacaaacatcttatcatattattttccatgctatttaaatttttcagtcaaatcataaatggcatacaaaatatattaattttaatattgtcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5038089 |
atttaatacaaacatcttatcatattattttccctgctatttaaatttttcagtcaaatcataaatggcataaaaaatatattaattttaatattgtcaa |
5037990 |
T |
|
| Q |
208 |
taattcttattacacgtgactgctattattgatagtttgatac |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5037989 |
taattcttagtacacgtgactgctattattgatagtttgatac |
5037947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University