View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_low_39 (Length: 251)
Name: NF20424_low_39
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 1630045 - 1629807
Alignment:
| Q |
1 |
atacttgaggctttcttacat----acaattactttaattttttattttaaataattactcttggatcatttaaatttaggtattgatggacttcacttc |
96 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1630045 |
atacttgaggctttcttacatgcatacaattactttcattttttattttaaataattactcttggatcatttaaatttaggtattgatggacttcacttc |
1629946 |
T |
|
| Q |
97 |
attgcacgagacataaccttccaaaataccgccggtccacacaagggtcaagctgtggcgctaagatcagcctccgatctctcagttttctatcggtgtg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1629945 |
attgcacgagacataaccttccaaaataccgccggtccacacaagggtcaagctgtggcgctaagatcagcgtccgatctctcagttttctatcggtgtg |
1629846 |
T |
|
| Q |
197 |
ccatatcaggttatcaagacactctgatggctcatgcac |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1629845 |
ccatatcaggttatcaagacactctgatggctcatgcac |
1629807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 55 - 235
Target Start/End: Complemental strand, 1606689 - 1606509
Alignment:
| Q |
55 |
ctcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagacataaccttccaaaataccgccggtccacacaagggtcaagctgtgg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1606689 |
ctcttggatcatttaaatttaggtattgatggacttcacttcattgcacgtgacataaccttccaaaataccgccggtccacacaagggtcaagcagtgg |
1606590 |
T |
|
| Q |
155 |
cgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacactctgatggctcatgcac |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1606589 |
cgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacactctgatggctcatgcac |
1606509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 9 - 235
Target Start/End: Original strand, 10820669 - 10820891
Alignment:
| Q |
9 |
ggctttcttacatacaattactttaattttttattttaaataattactcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagac |
108 |
Q |
| |
|
||||||||||| |||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10820669 |
ggctttcttacctacaattactttcatat----ttttaaataattactcttggatcatttaaatttaggtattgatggacttcacttcattgcacgtgac |
10820764 |
T |
|
| Q |
109 |
ataaccttccaaaataccgccggtccacacaagggtcaagctgtggcgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggtt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||| || ||||| |||||| | ||||| |||| |
|
|
| T |
10820765 |
ataaccttccaaaataccgccggtccacacaagggtcaagcagtggcgctccgatcagcctctgatctctccgtcttctaccggtgtacaatatcgggtt |
10820864 |
T |
|
| Q |
209 |
atcaagacactctgatggctcatgcac |
235 |
Q |
| |
|
| |||||||| || ||||||||||||| |
|
|
| T |
10820865 |
accaagacaccctcatggctcatgcac |
10820891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 55 - 235
Target Start/End: Complemental strand, 1623811 - 1623631
Alignment:
| Q |
55 |
ctcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagacataaccttccaaaataccgccggtccacacaagggtcaagctgtgg |
154 |
Q |
| |
|
|||||| ||| |||||||| ||| |||||||||||||| ||||||||||| ||||| ||||| |||||||| || ||||| ||||| || |||||||||| |
|
|
| T |
1623811 |
ctcttgaatcttttaaattcaggcattgatggacttcatttcattgcacgtgacattacctttcaaaatactgctggtcctcacaaaggccaagctgtgg |
1623712 |
T |
|
| Q |
155 |
cgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacactctgatggctcatgcac |
235 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1623711 |
cgctccgatcagcctccgatctctctgtcttctatcggtgtgctatatcgggctatcaagacactctgatggctcatgcac |
1623631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 55 - 233
Target Start/End: Complemental strand, 18781505 - 18781327
Alignment:
| Q |
55 |
ctcttggatcatttaaatttaggtattgatggacttcacttcattgcacgagacataaccttccaaaataccgccggtccacacaagggtcaagctgtgg |
154 |
Q |
| |
|
|||||| ||| |||||||| ||| |||||||||||||| |||||||| || |||||||||||||||||||| || ||||| || || ||||||||||||| |
|
|
| T |
18781505 |
ctcttgaatcttttaaattcaggcattgatggacttcatttcattgcccgcgacataaccttccaaaatactgctggtcctcataaaggtcaagctgtgg |
18781406 |
T |
|
| Q |
155 |
cgctaagatcagcctccgatctctcagttttctatcggtgtgccatatcaggttatcaagacactctgatggctcatgc |
233 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||||| ||||| || || |||||||| || ||||| ||||| |
|
|
| T |
18781405 |
cgctccgatcagcctccgatctctctgtcttctatcggtgtgctatatcgggctaccaagacacccttatggcccatgc |
18781327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University