View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_low_46 (Length: 225)
Name: NF20424_low_46
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 29 - 210
Target Start/End: Original strand, 3277050 - 3277231
Alignment:
| Q |
29 |
taaggtaaaattacaaatcatttttcacatataataactctttcttcatcaaataaacannnnnnnn-attatcatatacatcccaacacaaatcttttc |
127 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3277050 |
taaggtaaaatttcaaatcattttttacatataataactctttcttcatcaaataaacatttctttttattatcatatacatcccaacacaaatcttttc |
3277149 |
T |
|
| Q |
128 |
tttggagtcaaccagcacataagtannnnnnnnatccaagaaatatgtagctttgatttgtgtatttttctgcacaaaatatt |
210 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3277150 |
tttggagtcaaccaacacataagta-tttttttatccaagaaatatgtagctttgatttgtgtatttttctgcacaaaatatt |
3277231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University