View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_low_7 (Length: 490)
Name: NF20424_low_7
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 2e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 18 - 145
Target Start/End: Original strand, 38025201 - 38025335
Alignment:
| Q |
18 |
ttaagaacacttttagtatttccctttaaaattattaactt-------gtctctattttgtgtatgttaattaaaaaggattcatgtgtgctaattatga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38025201 |
ttaagaacacttttagtatttccctttaaaattattaacttgttacttgtctctatttcgtgtatgttgattaaaaaggattcatgtgtgctaattatga |
38025300 |
T |
 |
| Q |
111 |
tgtttattaattggtgaaatagaaaagaagaaatg |
145 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38025301 |
tgtttattaattgatgaaatagaaaagaagaaatg |
38025335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 186 - 250
Target Start/End: Original strand, 38025508 - 38025572
Alignment:
| Q |
186 |
gtgtcatcgactccttaatgccattgaatcggtaagttcataattaagatgattcgtaatttgtc |
250 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38025508 |
gtgtcgtcgactccttaatgccattgaatcggtaagttcataattaagatgattagtaatttgtc |
38025572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University