View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20424_low_9 (Length: 421)
Name: NF20424_low_9
Description: NF20424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20424_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 4e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 244 - 406
Target Start/End: Original strand, 3823731 - 3823893
Alignment:
| Q |
244 |
tcctttgcctcaacctgacattttcacttgtagggaagaaaagaaattgggaaaatttgaagaagaactttgatttgggttgctgctacccgttttcaga |
343 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3823731 |
tcctttacctcaacctgacattttcacttgtaaggaagaaaagaaattgggaaaatttgaagaagaactttgatttgggttgctgctacccgttttcaga |
3823830 |
T |
 |
| Q |
344 |
tttgggttgctgctcccatcttttcatcactttttaaaattcacccaaagaagagaaattggt |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3823831 |
tttgggttgctgctcccatcttttcatcactttttaaaattcacccaaagaagagaaattggt |
3823893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 38 - 134
Target Start/End: Original strand, 3823509 - 3823605
Alignment:
| Q |
38 |
tgcagttttgagcatggatgttaacattgaagagtgagattttagaggttgaggtgaaatagtgccatacaaaacagcgccaccacctcctctgtag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3823509 |
tgcagttttgagcatggatgttaacattgaagagtgagatttgagaggttgaggtgaaatagtgccatacaaaacagcgccaccacctcctctgtag |
3823605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University