View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20425_high_17 (Length: 322)
Name: NF20425_high_17
Description: NF20425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20425_high_17 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 3878866 - 3879187
Alignment:
| Q |
1 |
acatggcacatgttgtacttgattgccctcttctacatgaacttgatattggttcttgcaacaaacttcctgatgctgttattcgtgctgctgcaacttc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3878866 |
acatggcacaggttgtacttgattgccctcttctacatgaacttgatattggttcttgcaacaaacttcctgatgctgttattcgtgctgttgcaacttc |
3878965 |
T |
 |
| Q |
101 |
atgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatcttggttttctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3878966 |
atgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatcttggttttctt |
3879065 |
T |
 |
| Q |
201 |
gattcatcatactgcccaagcatatctttggaggtgtgcttcaaattgtatactcgcttttttgcatatgtaagcttgtattttgaactaaagtatatgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3879066 |
gattcatcatactgcccaagcatatctttggaggtgtgcttcaaattgtatactcgcttttttgcatatgtaagcttgtattttgaactaaagtatatgg |
3879165 |
T |
 |
| Q |
301 |
cttttctcttttaagtcggttc |
322 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3879166 |
cttttctcttttaagtcggttc |
3879187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 3864869 - 3865155
Alignment:
| Q |
1 |
acatggcacatgttgtacttgattgccctcttctacatgaacttgatattggttcttgcaacaaacttcctgatgctgttattcgtgctgctgcaacttc |
100 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||||| | |||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3864869 |
acatggcacaagttgtgcttaattgccctcttctgcttgaacttgatatgggttcttgccacaaacttcctgatgctgctattcgtgctgctgcaacttc |
3864968 |
T |
 |
| Q |
101 |
atgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatcttggttttctt |
200 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
3864969 |
atgccctcaactagtgaaactggacatgcgtaattgttcttgtgtcagcgatgaaacactgcgtgaaatagcacaacattgtcctaatcttggttttctt |
3865068 |
T |
 |
| Q |
201 |
gattcatcatactgcccaagcatatctttggaggtgtgcttcaaattgtatactcgcttttttgcatatgtaagcttgtattttgaac |
288 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||||||||| ||| |||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
3865069 |
gatgcatcatactgcccaaacatatctttggaggtgtgctttaaactgtatact-tattttttgcatatttaagattgtattttgaac |
3865155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 134
Target Start/End: Complemental strand, 8357532 - 8357452
Alignment:
| Q |
54 |
tcttgcaacaaacttcctgatgctgttattcgtgctgctgcaacttcatgccctcaactggtgaagctggacatgcgtaac |
134 |
Q |
| |
|
|||||| ||||||||||| |||||| ||| || | ||||||| ||||||||||| | | |||||| |||||||| ||||| |
|
|
| T |
8357532 |
tcttgccacaaacttccttatgctgctatcggttcggctgcaagttcatgccctctattagtgaagatggacatgtgtaac |
8357452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University