View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20425_high_24 (Length: 250)

Name: NF20425_high_24
Description: NF20425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20425_high_24
NF20425_high_24
[»] chr8 (1 HSPs)
chr8 (10-227)||(33225864-33226070)
[»] chr7 (1 HSPs)
chr7 (10-88)||(10528744-10528822)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 10 - 227
Target Start/End: Original strand, 33225864 - 33226070
Alignment:
10 attatactaaaatggaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttctttaaatgaaattttatttttt 109  Q
    |||||||||||||||||||||| || |||||| |||||||||||||         ||||||||||||||||||||| ||||||||| ||||| |||||||    
33225864 attatactaaaatggaaagaacaagtttgaaaacaacatccatatg---------ctgcactgaatccatcccttt-ctttaaatggaatttgatttttt 33225953  T
110 gtcaaccccc-acaaaagaatgatgcaaaatgaagtacttatgttaagctctccttttgcagtttatgggagcatatgtggaaccattaatgttgataat 208  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||   ||||||||||||| ||||||| |||| |||||| ||||||||||||    
33225954 gtcaaccccccacaaaagaatgatgcaaaatgaagtacttatgttaagctca--ttttgcagtttattggagcatctgtgaaaccatcaatgttgataat 33226051  T
209 cacggaacttttggaagct 227  Q
    |||||||||||||||||||    
33226052 cacggaacttttggaagct 33226070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 10 - 88
Target Start/End: Complemental strand, 10528822 - 10528744
Alignment:
10 attatactaaaatggaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttct 88  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10528822 attatactaaaatggaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttct 10528744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University