View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20425_high_27 (Length: 247)
Name: NF20425_high_27
Description: NF20425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20425_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 57 - 231
Target Start/End: Complemental strand, 42242604 - 42242437
Alignment:
| Q |
57 |
ttaggttttagatatctgattggtaacctccttttgatctttgacctctcaagatgtactattgtatacgtnnnnnnntgtactactattgtacatccaa |
156 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| | ||| | |||||||||||||||||||||| |
|
|
| T |
42242604 |
ttaggttttagatacctgtttggtaacctccttttgatctttgacctctcaagatgta---tagtaaa----aaaaaatgtactactattgtacatccaa |
42242512 |
T |
 |
| Q |
157 |
tacgttgtttaactatttgcgttgattttagagggtagatgaaaaatgctctaatacataatatacgtaaaagtt |
231 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42242511 |
tactttgtttaactatttgcgttgattttagagggtagatgaaaaatgctctaatacataatatacgtaaaagtt |
42242437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 9022330 - 9022389
Alignment:
| Q |
1 |
ttaaatactccaaaaaattacttttcctcactaaaatgctctatccaaacactctcttag |
60 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
9022330 |
ttaaatactccaaaaaattactttccctcattaaaatgctttatccaaacacactcttag |
9022389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 44609121 - 44609066
Alignment:
| Q |
1 |
ttaaatactccaaaaaattacttttcctcactaaaatgctctatccaaacactctct |
57 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| ||||||||||| |||| |
|
|
| T |
44609121 |
ttaaatactccaaaaa-ttactttccctcactaaaatgctttatccaaacacactct |
44609066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 13145178 - 13145131
Alignment:
| Q |
1 |
ttaaatactccaaaaaattacttttcctcactaaaatgctctatccaa |
48 |
Q |
| |
|
||||||||||||||||||||| || ||||| |||||| |||||||||| |
|
|
| T |
13145178 |
ttaaatactccaaaaaattacattccctcattaaaattctctatccaa |
13145131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 26378331 - 26378279
Alignment:
| Q |
1 |
ttaaatactccaaaaa-attacttttcctcactaaaatgctctatccaaacac |
52 |
Q |
| |
|
||||||||| |||||| ||||| |||||||| |||||| |||||||||||||| |
|
|
| T |
26378331 |
ttaaatacttcaaaaatattacatttcctcattaaaattctctatccaaacac |
26378279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 20357083 - 20357027
Alignment:
| Q |
1 |
ttaaatactccaaaaaattacttttcctcactaaaatgctctatccaaacactctct |
57 |
Q |
| |
|
||||||| | |||||||||||||| ||||| ||||||||||||||||||||| |||| |
|
|
| T |
20357083 |
ttaaatatttcaaaaaattactttccctcattaaaatgctctatccaaacacactct |
20357027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 1990890 - 1990834
Alignment:
| Q |
1 |
ttaaatactccaaaaaattacttttcctcactaaaatgctctatccaaacactctct |
57 |
Q |
| |
|
|||||| |||||||||||||| || ||||| |||||| || ||||||||||| |||| |
|
|
| T |
1990890 |
ttaaattctccaaaaaattacattccctcattaaaatactttatccaaacacactct |
1990834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 11004217 - 11004277
Alignment:
| Q |
1 |
ttaaatactccaaaaaattacttttcctcactaaaatgctctatccaaacactctcttagg |
61 |
Q |
| |
|
|||||| |||||||||||||| || ||||| |||||| |||||||||||||| |||||||| |
|
|
| T |
11004217 |
ttaaattctccaaaaaattacattccctcattaaaatactctatccaaacacactcttagg |
11004277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 3297203 - 3297147
Alignment:
| Q |
1 |
ttaaatactccaaaaaattacttttcctcactaaaatgctctatccaaacactctct |
57 |
Q |
| |
|
|||||| |||||||||||||| || ||||| |||||| |||||||||||||| |||| |
|
|
| T |
3297203 |
ttaaattctccaaaaaattacattccctcattaaaatactctatccaaacacactct |
3297147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University