View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20425_high_29 (Length: 230)
Name: NF20425_high_29
Description: NF20425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20425_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 62 - 216
Target Start/End: Complemental strand, 7834021 - 7833867
Alignment:
| Q |
62 |
agcccaccatctcctacaagatgccaagaaattaaagggaatgatcaattcttgctgggccactccatagcacttgtcttgttgccgtgtgtcagacact |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7834021 |
agcccaccatctcctacaagatgccaagaaattaaagggaatgatcaattcttgctgggccactccatagcacttgtcttgttgccgtgtgtcagacact |
7833922 |
T |
|
| Q |
162 |
atctcccattctccctttactcgaacctgtttgtgttgtgttggtgactctgtgc |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
7833921 |
atctcccattctccctttactcaaacctgtttgtgttgtgttggtgactttgtgc |
7833867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University