View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20425_low_25 (Length: 250)
Name: NF20425_low_25
Description: NF20425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20425_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 10 - 227
Target Start/End: Original strand, 33225864 - 33226070
Alignment:
| Q |
10 |
attatactaaaatggaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttctttaaatgaaattttatttttt |
109 |
Q |
| |
|
|||||||||||||||||||||| || |||||| ||||||||||||| ||||||||||||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
33225864 |
attatactaaaatggaaagaacaagtttgaaaacaacatccatatg---------ctgcactgaatccatcccttt-ctttaaatggaatttgatttttt |
33225953 |
T |
|
| Q |
110 |
gtcaaccccc-acaaaagaatgatgcaaaatgaagtacttatgttaagctctccttttgcagtttatgggagcatatgtggaaccattaatgttgataat |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||| |||||| |||||||||||| |
|
|
| T |
33225954 |
gtcaaccccccacaaaagaatgatgcaaaatgaagtacttatgttaagctca--ttttgcagtttattggagcatctgtgaaaccatcaatgttgataat |
33226051 |
T |
|
| Q |
209 |
cacggaacttttggaagct |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33226052 |
cacggaacttttggaagct |
33226070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 10 - 88
Target Start/End: Complemental strand, 10528822 - 10528744
Alignment:
| Q |
10 |
attatactaaaatggaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttct |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10528822 |
attatactaaaatggaaagaacgaggttgaaagcaacatccatatgacatactaactgcactgaatccatcccttttct |
10528744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University