View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20425_low_27 (Length: 247)

Name: NF20425_low_27
Description: NF20425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20425_low_27
NF20425_low_27
[»] chr1 (1 HSPs)
chr1 (136-235)||(31033877-31033976)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 136 - 235
Target Start/End: Original strand, 31033877 - 31033976
Alignment:
136 gctcttcgttgacacaactagaaaatttatttattttgacattcatttagccatgtttcaatatcggataaattgagacccattcaagtcaccggagtat 235  Q
    |||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||| |||| || |||||||| ||||||||||||||||| ||||||||    
31033877 gctctttgttaacacaactagaaaatttatttattttgacattcatttagccgtgtctcaaaattggataaatggagacccattcaagtcatcggagtat 31033976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University