View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20425_low_9 (Length: 417)
Name: NF20425_low_9
Description: NF20425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20425_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 8e-34; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 56 - 133
Target Start/End: Complemental strand, 8262743 - 8262666
Alignment:
| Q |
56 |
ttatttttgtaagtggcttcagtggggtgaaaactgtcccaaaacacatattccgaatcattggaacataaaggttca |
133 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8262743 |
ttatttttgtaagtgacttcagtggggtgaaaactgtcccaaaacacatattccgaatcattggaacataaaggttca |
8262666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 60 - 123
Target Start/End: Complemental strand, 8272039 - 8271976
Alignment:
| Q |
60 |
ttttgtaagtggcttcagtggggtgaaaactgtcccaaaacacatattccgaatcattggaaca |
123 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8272039 |
ttttgtacatggcttctgtggggtgaaaactgtcccaaaacacatattctgaatcattggaaca |
8271976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 64
Target Start/End: Complemental strand, 8264166 - 8264117
Alignment:
| Q |
15 |
ttatactatagtactatgaaaagagcgtgcttgataagaatttatttttg |
64 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8264166 |
ttatattacagtactatgaaaagagcgtgcttgataagaatttatttttg |
8264117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 344 - 397
Target Start/End: Complemental strand, 8270998 - 8270945
Alignment:
| Q |
344 |
aataccggtaaatttgatgtgaaatcatcatacccagcgccaccagatgcaaag |
397 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8270998 |
aataccagtaattttgatgtcaaatcatcatatccagcgccaccagatgcaaag |
8270945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 73 - 119
Target Start/End: Complemental strand, 8245869 - 8245823
Alignment:
| Q |
73 |
ttcagtggggtgaaaactgtcccaaaacacatattccgaatcattgg |
119 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||| |||| |||| |
|
|
| T |
8245869 |
ttcagtagggtgaaaactgtcccaaaacacataatccaaatcgttgg |
8245823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University