View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20426_low_12 (Length: 274)
Name: NF20426_low_12
Description: NF20426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20426_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 34425823 - 34426063
Alignment:
| Q |
13 |
tagggaaacaagtagggatattctgttattctataatacttt-aagtctaaaaaatattgaaataaactagcagctgaaaatggtaacatataacatttg |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34425823 |
tagggaaacaagtagggatattttgttattctataatacttttaagtctaaaaaatattgaaataaactagcagctgaaaatggtaacatataacatttg |
34425922 |
T |
 |
| Q |
112 |
ggcttacgatgagtcctgacgagctggatatatctcaatcaatttaactcttctgtcattcttcccatttgacccgaactttccaacaggtaaattcttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34425923 |
ggcttacgatgagtcctgacgagctggatatatctcaatcaatttaactcttctgtcattcttcccatttgacccgaactttccaacaggtatattcttc |
34426022 |
T |
 |
| Q |
212 |
agatcagtggatatgcctatcttaactatatgagtgggacc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34426023 |
agatcagtggatatgcctatcttaactatatgagtgggacc |
34426063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University