View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20426_low_15 (Length: 247)
Name: NF20426_low_15
Description: NF20426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20426_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 109 - 231
Target Start/End: Complemental strand, 31407535 - 31407413
Alignment:
| Q |
109 |
ttgacattttaaatgtagatacttgacgccttgaacaaaggagaaattccatcatcaggctctcttgtggaggttttcaacaaaggtattattgagagat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31407535 |
ttgacattttaaatgtagatacttgacgccttgaacaaaggagaaattccatcatcaggctctcttgtggaggttttcaacaaaggtattattgagagat |
31407436 |
T |
 |
| Q |
209 |
gtctcaagttatatggtgaaaag |
231 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31407435 |
gtctcaagttatatggtgaaaag |
31407413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 231
Target Start/End: Original strand, 38494571 - 38494678
Alignment:
| Q |
124 |
tagatacttgacgccttgaacaaaggagaaattccatcatcaggctctcttgtggaggttttcaacaaaggtattattgagagatgtctcaagttatatg |
223 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||||||| |||| |||||||||||| |||||||||| | ||| |||| |||||||| |||||||| |
|
|
| T |
38494571 |
tagatacttgaagccttgaacaagggagagattccatcaacaggttctcttgtggagattttcaacaaggacattcttgaaagatgtcttaagttataca |
38494670 |
T |
 |
| Q |
224 |
gtgaaaag |
231 |
Q |
| |
|
|||||||| |
|
|
| T |
38494671 |
gtgaaaag |
38494678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University