View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20426_low_8 (Length: 317)
Name: NF20426_low_8
Description: NF20426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20426_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 19 - 306
Target Start/End: Complemental strand, 48398260 - 48397973
Alignment:
| Q |
19 |
taaccatttcaaactctctgagttcggtccaatttgacctacttctacttctctctgtactaatggtccaaccgggtaaaacttaggttttccaggttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48398260 |
taaccatttcaaactctctgagttcggtccaatttgacctacttctacttctctctttactaatggtccaaccgggtaaaacttaggttttcctggttct |
48398161 |
T |
|
| Q |
119 |
tcctttagtaactccttgattggacccggttcaagttcaagaaaactgttctctataagtccatctgcttctctgtatctcttcgcgttgcgaaagacac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398160 |
tcctttagtaactccttgattggacccggttcaagttcaagaaaactattctctataagtccatctgcttctctgtatctcttcgcgttgcgaaagacac |
48398061 |
T |
|
| Q |
219 |
tttggtaagcatcgttcttcctgtcttgaagcgggtctagtaaatatttaccgtgaataggaatacagccgggaattttcacaggttc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48398060 |
tttggtaagcatcgttcttcctgtcttgaagagggtctagtaaatatttaccgtgaataggaatacaaccgggaattttcacaggttc |
48397973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University