View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20427_low_3 (Length: 422)
Name: NF20427_low_3
Description: NF20427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20427_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 88 - 404
Target Start/End: Original strand, 9025551 - 9025871
Alignment:
| Q |
88 |
ccaagaacatgaagtattgaaatattagtattca---catttttggtcatacaaaaggcattacaatttcaattattcaatagaagatctaacactgttt |
184 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |||||| |
|
|
| T |
9025551 |
ccaagagcatgaagtattaaaatattagtattcatcacatttttggtcatacaaaaggcattataatttcaattattcaatagaagatctaccgctgttt |
9025650 |
T |
|
| Q |
185 |
tttgctgacaaaatctaccaattagtcgtagttgatcacaaattgatagattgagtagaacatgcaaaagctggtcacca-ctcatccgaaacacgtaaa |
283 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
9025651 |
tttgctgacaaaatgtaccaattagtcgtagttgatcacaaattgacagattgagtagaacatgcaaaagctggtcatcatggcatctgaaacacgtaaa |
9025750 |
T |
|
| Q |
284 |
cagtgtttttgaaaattgtacattgacattctatcatcgattcacagttcaaccacacaattcattgaacctcttcagctgattcattgacacgttcaca |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9025751 |
cagtgtttttgaaaattgtacattgacattatatcatcaattcacagttcaaccacacaattcattgaacctcttcagctgattcattgacacgttcaca |
9025850 |
T |
|
| Q |
384 |
attcacatgtgttactatttc |
404 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
9025851 |
attcacatgtggtactatttc |
9025871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University