View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20429_low_11 (Length: 383)

Name: NF20429_low_11
Description: NF20429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20429_low_11
NF20429_low_11
[»] chr1 (1 HSPs)
chr1 (160-193)||(35392143-35392176)


Alignment Details
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 193
Target Start/End: Complemental strand, 35392176 - 35392143
Alignment:
160 tgctctttacccaaattgttttgctcatttccaa 193  Q
    ||||||||||||||||||||||||||||| ||||    
35392176 tgctctttacccaaattgttttgctcattcccaa 35392143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University