View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20429_low_13 (Length: 297)
Name: NF20429_low_13
Description: NF20429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20429_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 21 - 284
Target Start/End: Complemental strand, 33507637 - 33507381
Alignment:
| Q |
21 |
aattctaaccctattatgttactgttttatacatcttttatgccgctctattctttcattcttcttcaaactttttctagtcatatgttttcctgtcact |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33507637 |
aattctaaccctattatgttactgttttatatatcttttatgccgctctattctttcattcttcttcaaactttttctagtcatatgttttcctgtcact |
33507538 |
T |
|
| Q |
121 |
caagcattgttgtttctgttcatgtaagtttcatttacttcagaacgagaataatttcttatgag-tataatttcaagaacgaaaatcaatctcaaatct |
219 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| | | ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33507537 |
caagcattgtcgtttctgttcatgtaagtttcatttact--------actactttttcttatgagttataatttcaagaacgaaaatcaatctcaaatct |
33507446 |
T |
|
| Q |
220 |
gtgtttaatttttgtgtaggaatatcaagtccaagaaatatattgcagttgctgttgttctgtgc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33507445 |
gtgtttaatttttgtgtaggaatatcaagtccaagaaatatattgcagttgctgttgttttgtgc |
33507381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University