View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2042_low_10 (Length: 211)
Name: NF2042_low_10
Description: NF2042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2042_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 31 - 196
Target Start/End: Complemental strand, 36938178 - 36938013
Alignment:
| Q |
31 |
tggccaaagggtaatttacaattatatatattgtttattattttgtaatgtattggacaagattctttctctcaacctccctgtattttttggagcaacc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938178 |
tggccaaagggtaatttacaattatatatattgtttattattttgtaatgtattggacaagattctttctctcaacctccctgtattttttggagcaacc |
36938079 |
T |
 |
| Q |
131 |
tctctgttaggggtaaagtaattggtcgatggggacgactttggctgggagacacgtggactttat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938078 |
tctctgttaggggtaaagtaattggtcgatagggacgactttggctgggagacacgtggactttat |
36938013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University